Battaglia V, Fornarino S, Al-Zahery N et al. Haplogroup - an overview | ScienceDirect Topics Am J Hum Genet 2008; 82: 236250. P15 was identified at the University of Arizona and became widely known by 2002. Haplogroup G, together with J2 clades, has been associated with the spread of agriculture, especially in the European context. The South Ossetians and Svans generally south of North Ossetia have significant number of G2a1 persons, but population percentages have not yet been provided. Y chromosome genetic variation in the Italian peninsula is clinal and supports an admixture model for the Mesolithic-Neolithic encounter. While acknowledging that the inference of the age and geographic source of dispersals of Y chromosome haplogroups from the frequency and STR diversity data can be approximate at best, we speculate that this lineage could potentially be associated with the Linearbandkeramik (LBK) culture of Central Europe, as its highest frequency (3.45.1%) and Td estimate (Supplementary Table S4) of 108703029 years ago occur there. Mol Biol Evol 2011; 28: 29052920. P257 was first reported in 2008. SD was also calculated for the age estimates according to the following formula: 25/1000 (ASD0 variance)/0.00069. The expansion time of G-M406 in Anatolia is 12800 years ago, which corresponds to climatic improvement at the beginning of the Holocene and the commencement of sedentary hunter-forager settlements at locations, such as Gobekli Tepi in Southeast Anatolia, thought to be critical for the domestication of crops (wheat and barley) that propelled the development of the Neolithic. The non-clustering paraphyletic, hg G sub-group P303* residuals consist of samples from Near/Middle Eastern, Caucasian and European populations. The haplogroups contain many branches called subhaplogroups or subclades. Finally, to the east, G2a3a-M406 has an expansion time of 8800 years ago in Iran, a time horizon that corresponds to the first Neolithic settlements of the Zagros Mountains of Iran. and JavaScript. Haplogroup G ( M201) is a human Y-chromosome haplogroup. The most recent study (2010) estimates the common ancestor of all men in haplogroup G lived in Asia about 17,000 years ago, and the ancestor of the G2 subgroup lived about 15,000 years ago. Name: G-L14 Age: 7800 ybp 1700 CI 95% Expansion: 5200 ybp 1900 CI 95% Parent: G-L1 Note: This information does not imply an endorcement of YFull or their methods. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. Cinnioglu C, King R, Kivisild T et al. It was then learned that several subclades belong under L223, including: G-L91 was identified in 2009. Y-chromosomal diversity in Lebanon is structured by recent historical events. Amongst the Madjars, G1 was found at a rate of 87%. The Caucasus are today mainly the countries of Georgia, Armenia, Azerbaijan and southwestern Russia. Genetic evidence concerning the origins of South and North Ossetians. [12] The fourth site also from the same period is the tztal of the Italian Alps where the mummified remains of tzi the Iceman were discovered. Beginning in 2008, additional G SNPs were identified at Family Tree DNA (L designations) and Ethnoancestry (S designations). Forensic Sci Int-Gen 2007; 1: 287290. Am J Hum Genet 2002; 70: 265268. The naming of sub-clades is according to YCC nomenclature principles. In human genetics, Haplogroup G (M201) is a Y-chromosome haplogroup. These Neolithic European were descendants of Neolithic farmers from Anatolia, among some of the earliest peoples in the world to practice agriculture. Eur J Hum Genet 2010; 18: 463470. Am J Hum Genet 2004; 74: 788788. PAU thanks Professor Carlos D Bustamante. What is the geographic and historic origin of Y-DNA haplogroups Mitochondrial DNA variation of modern Tuscans supports the near eastern origin of Etruscans. Spatial autocorrelation analysis was carried out to assess the presence/absence of clines regarding informative G sub-haplogroups. Specifications for most markers have been previously reported,1, 17, 28 ISOGG 2011 (http://www.isogg.org/tree/). To accommodate for variability in sample sizes and hg G content, haplogroup diversity was calculated using the method of Nei37 only in the 52 instances when total population sample size exceeded 50 individuals and 5hg G chromosomes were observed. Martinez L, Underhill PA, Zhivotovsky LA et al. Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus. However, no clinal patterns were detected in the spatial autocorrelation analysis of the five sub-haplogroup frequencies with distance, suggesting that the distributions are not clinal but rather indicative of isolation by distance and demographic complexities. The network was obtained using the biallelic markers P303, M426, L497, U1, M527 and 19 STR loci (DYS19, DYS388, DYS389I, DYS389b, DYS390, DYS391, DYS392, DYS393, DYS439, DYS461 (TAGA counts), DYS385a,b, DYS437, DYS438, DYS448, DYS456, DYS458, DYS635, YGATAH4). In order to determine if one of these alternative SNPs represents a subclade of M201, the alternative SNPs must be tested in G persons who are negative for the known subclades of G. There are only a tiny number of persons in such a category, and only a tiny number of persons have been tested for G equivalent SNPs other than M201. 25 and 0.00069 denote the assumed average generation time in years and the effective mutation rate, respectively, and 1000 is used to convert the result of the equation (into thousands of years). G-P303*, also known as G2a2b2a* (previously G2a3b1*), and its subclades are now concentrated in southern Russia and the Caucasus, as well as, at lower levels, other parts of Europe and South West Asia, especially an area including Turkey, Iran and the Middle East where G2a2b2a may have originated. [23] About 6% of the samples from Sri Lanka and Malaysia were reported as haplogroup G, but none were found in the other coastal lands of the Indian Ocean or Pacific Ocean in Asia. Armenian DNA Project - News | FamilyTreeDNA Am J Hum Genet 2004; 74: 5061. Regueiro M, Cadenas AM, Gayden T, Underhill PA, Herrera RJ : Iran: tricontinental nexus for Y-chromosome driven migration. This is not surprising, as clines are not expected in cases of sharp changes in haplogroup frequency over a relatively small distance such as those observed for hg G, for instance between the Caucasus and Eastern Europe. [16] The concentration of G falls below this average in Scandinavia, the westernmost former Soviet republics and Poland, as well as in Iceland and the British Isles. The Turkish G-M377 is somewhat closer, but not identical. The Etruscans: a population-genetic study. (Previously the name Haplogroup S was assigned to K2b1a4. The G-P303 phylogenetic network was constructed using 248 G2a3b-P303-derived 19-locus haplotypes from populations representing Europe, Middle/Near East, South/Central Asia and the Caucasus and belonging to five sub-clades P303*, U1, M527, M426 and L497. (Previously the name Haplogroup M was assigned to K2b1d. Whereas the presence of Mideastern mtDNA in Tuscany43 supports the model of early Iron Age migrants from Anatolia (putative Etruscans) colonizing Central Italy,44 the occurrence of the G2a3b1c-L497 lineage in Italy is most likely associated to migratory flows from the north. Artefactual values below 0% values were not depicted. N-mtDNA - Background | FamilyTreeDNA . The Y-chromosomal haplogroup G (hg G) is currently defined as one of the 20 standard haplogroups comprising the global Y-chromosome phylogeny.1 The phylogeographic demarcation zone of hg G is largely restricted to populations of the Caucasus and the Near/Middle East and southern Europe. Thank you for visiting nature.com. The mutation involves a change from C to T.[citation needed] L223 is found on the Y chromosome at rs13304806. Because SNPs provide the most reliable method of categorization, each is allowed to represent an official G category. The 96 populations were collapsed into 50 regionally defined populations by excluding populations where the total G count was less than n=5. Ancient DNA reveals male diffusion through the Neolithic Mediterranean route. PLoS One 2009; 4: e5792. In 2009-10, Family Tree DNA's Walk through the Y Project, sequencing certain Y-chromosome segments, provided a number of new G SNPs with the L designation. The G-L13 subclade is most common in north central Europe, and G-Z1266 is most common in the western Caucasus Mountains. Origin. The genetic variation in the R1a clade among the Ashkenazi - Nature Interestingly, the L30 SNP, phylogenetically equivalent to M485, M547 and U8, was detected in an approximately 7000-year-old Neolithic specimen from Germany, although this ancient DNA sample was not resolved further to additional sub-clade levels.39. It encompasses a small group of Hispanic men who also so far all have the odd value of 13,21 at the YCA marker. A more compact cluster of Near/Middle Eastern samples is also resolved in the network. G2a3a-M406 has a modest presence in Thessaly and the Peloponnese (4%),10 areas of the initial Greek Neolithic settlements. [44] The "U" SNPs were identified in 2006 but not published until 2009.[45]. Princeton: Princeton University Press, 1994. Two additional markers, DYS38829, 30 and DYS46131 were typed separately. Behar DM, Yunusbayev B, Metspalu M et al. Am J Hum Genet 2001; 68: 10191029. Almost all haplogroup G1 persons have the value of 12 at short tandem repeat (STR) marker DYS392 and all will have the M285 or M342 SNP mutation which characterizes this group. These are found at: rs9786910, rs9786537, rs2713254, rs35567891 and rs34621155 on the Y chromosome. Men who belong to this group but are negative for all G2 subclades represent a small number of haplogroup G men. His male-line descendants appear to remained rooted in the region for tens of thousands of years while the Ice Age was in full swing. In contrast to G1, the absolute majority of hg G samples belonged to G2-P287-related sub-clades, with the vast majority of them being associated with G2a-P15-related lineages. We emphasize that our assessments are based solely on contemporary DNA distributions rather than actual prehistoric patterns. For the multi-copy STR DYS389I,II the DYS389b value was DYS389I subtracted from DYS389II. In contrast, the only U1 representative in Europe is the G-M527 lineage whose distribution pattern is consistent with regions of Greek colonization. Haplogroup_G_(Y-DNA) White PS, Tatum OL, Deaven LL, Longmire JL : New, male-specific microsatellite markers from the human Y chromosome. The extreme rarity of G-M377 in northern Pakistan could indicate that G2b in this area originates outside the region and was brought there in the historic period, perhaps from further west (Pakistan was part of both the Achaemenid Persian Empire, conquered by Alexander the Great, and then formed a part of the Greco-Bactrian Kingdom). G-L42/S146 (Y-DNA) - geni family tree Am J Hum Genet 2008; 82: 873882. Considering these issues, we acknowledge that the variance of the age estimates may be underestimated. Y-chromosomal evidence of the cultural diffusion of agriculture in Southeast Europe. [29][30][31] 3% of North African Berbers were found to be haplogroup G.[32] 2% of Arab Moroccans and 0.8% of Berber Moroccans were likewise found to be G.[33]. Several G-PF3359 subclades, based on shared STR markers, probably exist. There were only a few G categories until 2008 when major revisions to categories were made. The discovery of new SNPs can result in assignment of new names to haplogroup categories. So far all G2a1 persons have a value of 10 at STR marker DYS392. Haplogroup G first locations (T. Kandell). The SNP L497 encompasses these men, but most G-L497 men belong to its subclade G-Z725, also known as G-DYS388=13. Eur J Hum Genet 2003; 11: 535542. K-M2313*, which as yet has no phylogenetic name, has been documented in two living individuals, who have ethnic ties to India and South East Asia. Hum Genet 2004; 114: 127148. The mutations involved may be complicated and difficult to interpret. Hg G is most common in the Caucasus with a maximum frequency exceeding 70% in North Ossetians,2, 3 decreasing to 13% in Iran4 and then rapidly dissipating further eastward. Origins and history of European Y-DNA and mtDNA haplogroups So far the men positive for this have had Irish, English, Dutch, Lebanese and/or Turkish (Armenian surname) ancestry. Network of 248 samples P303 derived from Supplementary Table S3. [24] Haplogroup G-M201 is believed to have been relatively absent during Neolithic India; the frequencies of the G2a-P15 subclade for example was negligible in indigenous Indian populations. The authors of the Spanish study indicated that the Avellaner men had rare marker values in testing of their short tandem repeat (STR) markers. This is achieved by comparing the haplotypes through the STR markers. Men with the haplogroup G marker moved into Europe in Neolithic times. In the meantime, to ensure continued support, we are displaying the site without styles Although hg G1 frequency distribution, overall, extends further eastward as far as Central Asian Kazakhs (present even among Altaian Kazakhs38 with identical STR haplotypes compared with the main Kazakh population), it is virtually absent in Europe. The M201 SNP mutation that characterizes haplogroup G was identified at Stanford University and was first reported in 2001. Y-DNA Haplogroup G-M201 - Marres [41] These classifications are based on shared SNP mutations. Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF : New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree. Spatial frequency maps for hg G sub-clades that attained 10% frequency in at least one population were obtained by applying the haplogroup frequencies from Supplementary Table S1. G2a1a persons also typically have higher values for DYS385b, such as 16, 17 or 18, than seen in most G persons. See: Poznik. Notably no basal G-M201*, Page94*(xM285, P287) chromosomes were detected in our data set. Balanovsky O, Rootsi S, Pshenichnov A et al. Age: About 7,800 years ago Origin: Eurasia Y-Haplotree. Am J Hum Genet 2003; 72: 313332. G-M377, now also known as G2b1, has previously been designated G2b and G2c. The Network 4.6.0.0 (Fluxus-Engineering) program was used (median-joining algorithm and the post-processing option). The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. See more. (Behar et al., 2012b) Origin Most researchers consider the birthplace of G to have been born in East Asia. The most detailed SNP mutation identified was S126 (L30), which defines G2a3.[11]. A network of 61 G2c-M377 lineages from Europe, the Near/Middle East and Central and South Asia reveals founder lineages (one pronounced founder in Ashkenazi Jews and a far distant one among South Asian individuals) and diverged lineages (Supplementary Figure S1). The genetic heritage of the earliest settlers persists both in Indian tribal and caste populations. Specifically, we intersected these criteria by applying the following filters. Paleolithic Y-haplogroup heritage predominates in a Cretan highland plateau. In the ten remaining populations, haplogroup diversity spanned from a low of 0.21 in Adyghes, to highs of 0.88 in Azeris (Iran) and 0.89 in eastern Anatolia and 0.90 in Armenia. Haplogroup G2a1 (also known as G-FGC753 and previously as G-L293) and its subclades represent the majority of haplogroup G samples in some parts of the Caucasus Mountains area. It has been found in Mexican mestizos. The origin of haplogroup G is controversial. Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the Mediterranean area. Eur J Hum Genet 2004; 12: 855863. Men who belong to this group but are negative for all its subclades represent a small number today. [43] L240 was identified in 2009. The highest percentage of G-P303 persons in a discrete population so far described is on the island of Ibiza off the eastern Spanish coast. Frontiers | The Geographic Origins of Ethnic Groups in the Indian Samples have been identified in England, Germany, Montenegro (Bosniak), Spain, Cyprus (Greek), Turkey, Armenia, Georgia, Lebanon, Syria and Kuwait. The next largest subclade of G-P303 is characterized by the presence of the U1 mutation. The 12f2a mutation, which characterizes haplogroup J, was observed in 445 subjects. Haplogroup Definition & Meaning | Dictionary.com mtDNA G | Haplogroup Nat Commun 2012; 3. de Knijff P, Kayser M, Caglia A et al. In Turkey, the South Caucasus and Iran, haplogroup G reaches the highest percentage of national populations. You belong to a subgroup of haplogroup G (G-M201), The Caucasus Mountaineers, and your oldest. The P303 SNP defines the most frequent and widespread G sub-haplogroup. The identities of the specific 19 loci that define the STR haplotypes are reported in Supplementary Table S3 and Figure 4 legend. A high percentage of G-Z1903 men belong to its subclade, G-Z724. Capelli C, Brisighelli F, Scarnicci F, Blanco-Verea A, Brion M, Pascali VL : Phylogenetic evidence for multiple independent duplication events at the DYS19 locus. The most recent study (2010) estimates the common ancestor of all men in haplogroup G lived in Asia about 17,000 years ago, and the ancestor of the G2 subgroup lived about 15,000 years ago. OS thanks the Italian Ministry of the University: Progetti Ricerca Interesse Nazionale 2009 and FIRB-Futuro in Ricerca 2008 and Fondazione Alma Mater Ticinensins. The British samples have inconsistent double values for STR marker DYS19 in many cases. New York: Columbia University Press, 1987. The Iceman belongs to haplogroup G2a2b [13] (earlier called G2a4). Iceman tzi, known to have been a haplogr. Russ J Genet 2004; 40: 326331. The effective mutation rate at Y chromosome short tandem repeats, with application to human population-divergence time. Thus inferences regarding migratory histories must be viewed cautiously, as diversities may have changed over the time spans discussed. G-L91 would seem to encompass a significant proportion of men belonging to G. L91 is found so far in scattered parts of Europe and North Africa and in Armenia. Anyone you share the following link with will be able to read this content: Sorry, a shareable link is not currently available for this article. [10], A skeleton found at the Neolithic cemetery known as Derenburg Meerenstieg II, in Saxony-Anhalt Germany, apparently belonged to G2a3 (G-S126) or a subclade. [25], In the Middle East, haplogroup G accounts for about 3% of the population in almost all areas. Among Jews in Israel drawn from many areas of the world, G-M377 constituted 3.7% in one study. The overall coalescent age estimate (Supplementary Table S4) for P303 is 12600 years ago. Thus, these estimates should be viewed as the upper bounds of dispersal times. For this are several indications. In other words, these mutations are so unique that they could only come from other cells with the same mutations. Parallel evolution of genes and languages in the Caucasus region. Genome Res 2008; 18: 830838. The SNP L177 (a.k.a. It is a branch of Haplogroup F (M89), and is theorized to have originated, according to the latest thinking, in the Near East or Southern Asia, likely in the region that is now northern India, Pakistan, and Afghanistan. G2a2b1 so far has seldom surfaced in northern Africa or southern Asia, but represents a small percentage of the G population in the Caucasus Mountains region and in Iran. the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Herein . Am J Hum Genet 2012; 90: 573. G2a2b2a is also found in India. Interestingly, the decrease of hg G frequency towards the eastern European populations inhabiting the area adjacent to NW Caucasus, such as southern Russians and Ukrainians,18, 40 is very rapid and the borderline very sharp, indicating that gene flow from the Caucasus in the northern direction has been negligible. Google Scholar. Supplementary Information accompanies the paper on European Journal of Human Genetics website, Rootsi, S., Myres, N., Lin, A. et al. Haplogroup G-M285 - Wikipedia Population codes: Baltics (Blt), Belarusians (Blr), Poles (Pol), Ukrainians (Ukr), northern Russians (NRu), southern and central Russians (SRu), Circum-Uralic (CUr), Germans (Ger), Central Europeans (CE), Iberians (Ibr), French (Fra), Sardinians (Srd), Corsica (Cor), Sicilians (Sic), Italians (Ita), Switzerlands (Swi), Western Balkans (WB), Romanians (Rmn), Bulgarians (Bul), Crete (Crt), Greeks (Grc), Anatolian Greeks (AG), Egyptians (Egy), Near/Middle Easterners (ME), Ashkenazi Jews (AJ), Sephardic Jews (SJ), Arabian Peninsula (AP), Palestinians (Pal), Druze (Drz), Western Turks (WTu), Central Turks (CTu), Eastern Turks (ETu), Iranians (Irn), Abkhazians (Abh), Armenians (Arm), Georgians (Grg), South Ossetians (SOs), Iranian Azeris (Azr), Abazins (Aba), Adyghes (Ady), Balkars (Blk), Cherkessians (Crk), Kabardins (Kab), Karachays (Kar), Kuban Nogays (Nog), North Ossetians (NOs), Chamalals (Cha), Ingushes (Ing), Kumyks (Kum), Central Asians (CA), Pakistani (Pak). The oldest skeletons confirmed by ancient DNA testing as carrying haplogroup G2a were five found in the Avellaner cave burial site, near Les Planes d'Hostoles, in Catalonia, Spain and were dated by radiocarbon dating to about 5000 BCE. [42] The technical specifications of M201 are given as: refSNPid is rs2032636..Y chromosome location of 13536923.forward primer is tatgcatttgttgagtatatgtc..reverse primer is gttctgaatgaaagttcaaacg..the mutation involves a change from G to T. A number of SNPs have been identified with seemingly the same coverage in the population as M201. (b) Principal component analysis by hg G sub-clades: (A) M285, P20, P287, P15, L92 P16, M286, M485, P303, U1, L497, M527, M406, Page19, M287 and M377 sub-haplogroups with respect to total M201. [21] In a study of 936 Indians, haplogroup G made up less than 1% of the sample and was completely absent in the tested Northwestern Indian population. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa. [8][9], Furthermore, the majority of all the male skeletons from the European Neolithic period have so far yielded Y-DNA belonging to this haplogroup. Haplogroup G is observed in this survey as G1-M285 and G2a-P15. Google Scholar. While it is found in percentages higher than 10% among the Bakhtiari, Talysh people, Gilaki, Mazandarani and Iranian Azeris, it is closer to 5% among the Iranian Arabs and in some large cities. In Russia, Ukraine and Central Asia, members of various ethnic minorities and/or residents in particular localities possess G-M201 at its highest levels in the world even though the average rate at the national level is about 1% or less. Principal component analysis based on G sub-haplogroup frequencies was performed using the freeware POPSTR program (http://harpending.humanevo.utah.edu/popstr/). Another frequent sub-clade of the G2a3-M485 lineage is G2a3a-M406 (Figure 2e). The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y chromosome perspective. Eur J Hum Genet 2008; 16: 374386. Haplogroup A0-T is also known as A-L1085 (and previously as A0'1'2'3'4). Haplogroup G is a branch on the maternal tree of human kind. Semino et al. Sims LM, Garvey D, Ballantyne J : Improved resolution haplogroup G phylogeny in the Y chromosome, revealed by a set of newly characterized SNPs. We attempted to localize the potential geographic origin of haplogroup G-M201 by considering those locations containing both G1-M285- and G2-P287-related lineages as well as the co-occurrence of high sub-haplogroup diversity. Semino O, Magri C, Benuzzi G et al. Haplogroup L2b1a is a branch on the maternal tree of human kind. In Europe west of the Black Sea, Haplogroup G is found at about 5% of the population on average throughout most of the continent. The coalescent times (Td) of various haplogroups were estimated using the ASDo methodology described by Zhivotovsky et al,32 modified according to Sengupta et al.13 We used the evolutionary effective mutation rate of 6.9 104 per 25 years, as pedigree rates are arguably only pertinent to shallow rooted familial pedigrees,33 as they do not consider the evolutionary consequences of population dynamics including the rapid extinction of newly appearing microsatellite alleles. Haplogroup G men who belong to this group, but are negative for all G2a subclades, are uncommon in Europe but may represent a sizeable group in so far poorly tested areas east of Turkey. An assessment of the Y-chromosome phylogeography-based proposal that the spread of G2a-L497 chromosomes originated from Central Europe could be achieved by typing this SNP in the Holocene period human remains from Germany31 as well as those from France and Spain.45, 46 Certainly, Y chromosome represents only a small part of human genome and any population-level interpretation of gene flow in this region would have to be supported by genome-wide evidence. Here we address this issue with a phylogeographic overview of the distribution of informative G sub-clades from South/Mediterranean Europe, Near/Middle East, the Caucasus and Central/South Asia. Zhivotovsky LA, Underhill PA, Feldman MW : Difference between evolutionarily effective and germ line mutation rate due to stochastically varying haplogroup size. Moreover, the accuracy and validity of the evolutionary rate has been independently confirmed in several deep-rooted Hutterite pedigrees.34 Furthermore pedigree rate-based estimates cannot be substantiated, as they are often inconsistent with dateable archeological knowledge, for example, as clearly illustrated regarding the peopling of the Americas.35 Coalescent times based on 10 STR loci (DYS19, DYS388, DYS389I, DYS389b, DYS390, DYS391, DYS392, DYS393, DYS439, DYS461-TAGA counts) and the median haplotypes of specific hg G sub-haplogroups are presented in Supplementary Table S4. It is provided at the request of readers. Haplogroup K2b1 (P397/P399) is also known as Haplogroup MS, but has a broader and more complex internal structure. Circles represent microsatellite haplotypes, the areas of the circles and sectors are proportional to haplotype frequency (smallest circle corresponds to one individual) and the geographic area is indicated by color. Taken as a collective group, P303-derived chromosomes are the most widespread of all hg G lineages (Supplementary Table S1 and Figure 2b) and clearly display differential geographic partitioning between L497 (Figure 2c) and U1 (xM527) (Figure 2d). [Origin of European 3/6] First Farmer of Europe and Y-DNA Haplogroup G [4], Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. Although not exceeding 3% frequency overall, haplogroup G1-M285 reflects a branching event that is phylogenetically equivalent to the more widespread companion G2-P287 branch in the sense that both branches coalesce directly to the root of G-M201. The presence of hg G was first reported in Europe and Georgia5 and later described in additional populations of the Caucasus.6 Subsequently, several data sets containing hg G-related lineages have been presented in studies of different European populations7, 8, 9, 10 and so on, as well as studies involving several Middle Eastern and South Asian populations.4, 11, 12, 13, Hg G, together with J2 clades, has been associated with the spread of agriculture,5 especially in the European context.
Faint Positive Covid Test Mumsnet,
Mars In Aquarius Unpredictable,
Lockheed Model 12 Electra Junior For Sale,
Gloucester High School Football Roster,
Articles H